IS Name: ISStma1 - Family: IS481
Type: Complete

Composed by 1 ORFs
ORF(s): Smlt0558
% of size:100% of reference copy ISStma1

IR Left:
TGTGATCTCTCTGTACGTTGTTCATCCGGGACATCTTTGGAAAATGGTGGT
IR Right:
TGTGTAAACCCACCACGTTGTTCAGCAGGACTCTGGAAATAGGTGGCTGGC
Borders:
ACGGGTTGATCCGCTGGGGACGACCCGACGGGGTAGAGTCGACT (GTTAGT) CGACTATCGCGCGCAGCGCGGGGTTCTCGCGGCCGGATGGGAGA
GC% Left (500bp): 68%
GC% IS: 61%
GC% Right (500bp): 64%

IS Sequence
TGTGATCTCTCTGTACGTTGTTCATCCGGGACATCTTTGGAAAATGGTGG
TTACCACACCTCTCCAGACCCCAAAGAGCCCGGATGAACCACCATAAAAA
TGCCCGTTTGACCGTCCATAGTCGAGCACTTCTTATTCGCCGCATCCTCC
ACGAGGGCCTGCGCCCAGAGGAAGCAGCCCAAGCATGCGGCGTAAGTGTG
CGTACGGCCTACAAATGGCTGGCCCGATTCCGCCAGTTCGGGGCACCGGG
GCTGGAAAACCGCAGCTCACGGCCTCACCAGACGCCGCATGCCACACCTG
CTCCGGTAATCGAGCAAATCAAGGAGCACCGCCGTAAACGGCAGACCTAC
CTGACCATCTCCAAGGCGCTGGGGGTCGGCCACAGTACGATTTCAAGGCT
GATGCGTGCCCACGGCCTCAATCGGCTGTGTCGGCTTGAACCGCCCAAGG
AGGTCATCCGATACGAATACGATCAGCCCGGAGGGCTGCTGCACCTGGAC
ATCAAGAAGCTGGGCAACTTCCAGCGGCCAGGGCACAGAACCGATGCCAA
ACGTCGGGGAAACGCCGCTGGCGGTGGCTGGGGCTACGTCCACGTGGCCA
TCGACGATCACTCCCGGGTCGCCTTCAGCAGCGTCCACCCCAACGAACAG
GCCGAAACCGCCTGCCAGGCGCTGCTGGGCGCTCTGCAGTACTACGCCAG
CCTGGGAATCACCTTCAAGCGGATCCTGACCGACAACGGTGCCTGCTATC
GCTCCACCGCCTTTGCCAAGCTGCTCAAATCCCTTGGGATCAAGCACATC
AGAACCAAGCCCTACACGCCGCGGACCAATGGCAAAGCCGAGCGCTTCAT
CCAAACCAGCCTGCGCGAATGGGCCTACGCCCGCGAATACGCCTCCTCGG
ACCAGCGCAATTCCGTGCTGACCCAATGGCTGCACCACTACAACTGGCAC
CGCCCTCACATGGGGATCGGTGGCCAGCCACCTATTTCCAGAGTCCTGCT
GAACAACGTGGTGGGTTTACACA