IS Name: ISStma1-p - Family: IS481
Type: Partial

Composed by 1 ORFs
ORF(s): not_found
% of size: 7% of reference copy - ISStma1

IR Left:

IR Right:

Borders:

GC% Left (500bp): 60%
GC% IS: 49%
GC% Right (500bp): 57%

IS Sequence
TGTGATCTCTCTGTACGTTGTTCATCCGGGACATCTTTGGAAAATGGTGG
TTACCACACCTCTCCAGACCCCAAAG