IS Name: ISStma10 - Family: IS630
Type: Complete

Composed by 1 ORFs
ORF(s): Smlt1323
% of size:100% of reference copy ISStma10

IR Left:
CGGCATGATTTATTCATGAACTTTTGTAGATTGCTTGAGTCGAACGTTCAT
IR Right:
CGGCGGGGATTATTCATGAGGCCGCATAGGCGACATGCTTGTCACCAAAGT
Borders:
CAACGCCATGCTTGCACGGGTAAGGAGAAGTCCTGCCTGCCTTATAAACT () GATCAATAGAAGCGCCCAACTTTCTCCGGGGAAAGTCACAGCACCCGAAA
GC% Left (500bp): 60%
GC% IS: 56%
GC% Right (500bp): 59%

IS Sequence
CGGCATGATTTATTCATGAACTTTTGTAGATTGCTTGAGTCGAACGTTCA
TGGAAAAAGAAGATGCACGCAAGCAGTCGCGGGAAGTGCTGCATGAACGG
CGCAAGCAGGTCATCCGCTTGCATCGAAAAGGTGTTGGCGTGATGCAGAT
CGTTGAGCAAACCGGGCTCAGTTGGTCTGGGGTTAACACTGCACTGCGCC
TGTTCGAGCAAGGCGGTGCGGCCGCACTCAAGCCCCACGCCAGGGGAAAG
AAACCAGGTAGTGGACGCAGCCTGAGCACTGAGCAAGAGCGCGTGATTCG
AATGACCATCATCGACAAACGCCCAGAGCAGATCAAGATGGAGTTCGCGC
TTTGGAGTCGGCCCGCAGTGCGCGAACTCATTGAACGCGACCTGGGGAAC
AAGCTGTCTGTCCGGGCGGTGGGCGACTATCTGGCACGCTGGGGTTTTAC
ACCGCAAAAGTCGATCAAGAAAGCCTACGAGCAGCGGCCCGAGGCCGTCC
AGGCCTGGCTCGAAGATGAATACCCCACCATTGAGGCCAGAGCCAAGCGT
GAAGGCGCAGAAATTCATTGGGGTGACGAAACAGCGCTGGTCAACACGGA
TGTGCGTGGCAGAAGTTACGCACCTGCGGGCCAAACACCAGTGACGCGCG
CAGTCGGCGGAACGCGGCAAAAGCTCTCCATGATTGCAACCGTCACCAAC
CAGGGCAAAACGCGCTGGATGATTATTGACGAGGCGTTCAATTCAGACAG
GCTGATCGAGTTCATGCAGGCCTTGATCAAGGAGTCGCAGGGCAAGAAGA
TATTCCTGATTCTGGACAACCTGAGGGTGCACCACAGCAAGCCAGTCAAG
GAGTGGGCGACACAGCACAAACAGGACATTGAATTGTTCTACCTGCCCAG
CTACAGCCCTGAGCTCAACCCAGAGGAGCGGCTGAACGCAGATTTGAAGC
ATGCGATTGGCAGCAAGGTTCCGGTGCGAACCAAGGCCAAGCTGCGCGCA
GCGGCGACTGAACACATGACGATGTTGGAGAACACACCAGAGCGGGTCAA
GAAGTACTTTGGTGACAAGCATGTCGCCTATGCGGCCTCATGAATAATCC
CCGCCG