IS Name: ISStma11 - Family: ISL3
Type: Complete

Composed by 5 ORFs
ORF(s): Smlt2413-Smlt2412-Smlt2411-Smlt2410-Smlt2409
% of size:100% of reference copy ISStma11

IR Left:
GGGTATCCGGAATCTGGTGTGGGTTCTGGCTCCTTGGGTCTTTGTAGCTAT
IR Right:
GGGTATCCGGATTTTAGTGTGGGAAGACCGCACTAGCCCTTCTTGTCTGAC
Borders:
GAAGGCCGAGGTGAAACGCCTGACTGAGGAGCGCGACATCCT (AAAAAAAG) CCGCGGCGTACTTCGCCAAGGGATGACGGCGAAGTACGCTTT
GC% Left (500bp): 60%
GC% IS: 63%
GC% Right (500bp): 61%

IS Sequence
GGGTATCCGGAATCTGGTGTGGGTTCTGGCTCCTTGGGTCTTTGTAGCTA
TCACTTTCAAAGAATGGATTTTGGTGTTGGACGGCTGAGCGGATGTGCTA
GAGTAAAAGTCGGATTTCAGTGTGGGTTCGCCCAAGGTGCTGAGTGACGG
ACTTTCTCCAGCTGCGAAGCCTGAAGACGCTTGAAATCCTGACCAGCGAG
GACAGTTACGTCGTCAAGGCCGAAGGCGTCAATCAGTGGGTGACCTGCCC
GCTGTGCAAGACCGGATGCCTGCATGGTCACGGCTCACAGGAACAGTCGT
TTCAGGACACACCGACGCACGGCAAACCCGTCGTGATCTTCATCCAGCGC
CGTCGCTATCGCTGTACAAGCTGCACCAAGACCTTGTTTGAGCCTGTGGC
GGACCTTGATGGAAAACGCCAAGCCACGGCGCGTCTGGTGCGTTATATCC
GCGACCAGTCCTTCTCCAAGACCTTTGCGGCCCTTGCCCGGGAAGTAGCC
GTGGAAGAAAAGACGGTCCGCCACGTCTTCGACGATTTCATCGAGGAGGT
CGAGGCCAAGACCCAGTTCCGGACGCCGCGGGTGCTGGGTATCGACGAGC
TCAAGATCATCGGCCAGTACCGGGCCATGATCACCAACGTCGAGCGCAAG
ACCGTGTTCGATATCCGCCCCAGCCGGGCCAAAGCCGAGTTGATGCCCTA
TTTCCGCGACCTGCGGGACAAGGACTCGGTCGAGTGGGTGGCGATGGACA
TGTACCACGTTTATCGGCAGGTGGTGCGCGCCACGCTGCCACAGGCCCGG
ATCGTGGTCGATCGATTCCATATCCAGCGCATGGCGAACGACGCGCTGGA
GAAGCTGCGCAAGCGCATTCGCAAGGATTTGTCCACCCGGCAGCGCCTCA
AACTCAAGGACGAGCGGTTCCTGCTGCTCAAGCGGCAGCACGACCTGACA
GGGAGAGATATGGACCGGATGCGGGAATGGTTCCAACAGTTCCCGCTCCT
AAGCGAAGCCCACGCGCTCAAGGAAGGATTTCTGTCGATCTGGGATCAGA
AGACCCGCCCAGCAGCAGAAGCCGCCTGCGCGAAGTGGCAGGCCAATATT
CCGACCGAATTGGCGGCCACGTTCAAGGACCTGACCACCGCCGTGCACAA
CTGGCACGACGAAATCTTCGCCTACTTCGAGCAGCCGATTACCAATGCCT
ATACTGAGTCAGTCAACCGAGTGGCCAAAGACATGAACCGCATGGGCAGG
GGTTACAGCTTCGAGGTGCTTCGGGCGCGCATGCTCTACGACAAGAAGGC
GCGCAAGGATGGCTCGGTTATCGAAACCGTGTTGGTCGATGACGACGACC
CAATGACCACGGACTTCGTGTTCCAGCGGATGACCACGGCGGCAACGCGC
AAGAAGAAGATCACGCGCGTGGTCGAGTACGGCCCCTATCTCCCGACGCT
GGCGCGGCTACTCGAAGAGGGGTATTTCGAATAGTCCTCAACCCATTGTG
CAAGAGGCGGCGCTTCAGCCTGAATTTGTGATTCAGCCGATGAAGCATAG
GTAAGAGGCCCAGCCACTACCCCGCGCAACAGGACAGTTGCTTTACGTCC
TTGGTGAAGGTTTGTGCCGCGAGTTTCAGCCCCTCGACCATCGTCAGGTA
GGGGAATAACTGGTCGGCCAACTCTCGCACCGTCATGCGGTTGCGAATCG
CCAGTACTGCGGTTTGGATCAGCTCGCCTGCTTCCGGGGCTACCGCTTGC
ACGCCGATCAGTCGTCCCGAACCGGCCTCCGAAACCAGCTTGATGAAACC
GCGCGTGTCGAAGTTGACCAGCGCCCGGGGCACGTTGTCGAGCGTCAGCG
TGCGGCTGTCGGTCTCGATACCGTCGTGGTGCGCTTCGGCTTCGCTGTAG
CCCACGGTGGCGACCTGCGGGTCGGTGAACACCACCGCCGGCATCGCCGT
CAGATCCAGCGTCGCGTTGCCACCCGTCATGTTGATTGCAGCGCGGGTGC
CGGCCGCCGCCGCGACGTAGACGAACTGCGGCTGGTCAGTGCAGTCGCCG
GCGGCATAGATGTGCGGCACGGTAGTGCGCATCGCGTGGTCGATGGTGAT
GGCGCCTTGCGCATTGACCACCACACCGGCCGCGTCGAGGTTGAGCGTGC
GGGTGTTTGGGGTGCGGCCGGTGGCGAACAACAGCCGGTCGGCATGCAGT
TCGCCGCGTTCGGTGGTGAGCACGAATTCCCCATCCTCATAGGCGACCTG
GCTGGCCTGGGTGTGGTCCAGCACTTCGATGCCTTCGGCGCGGAACACGG
CCGTGATGGCCTCGCCAATGGCGGGGTCTTCGCGAAAGAACAGTGTGCTG
CGCGCCAGCATGGTCACCTTGCTGCCCAGCCGGGCAAAGGCCTGCGCGAG
TTCGACGGCCACCACCGACGAGCCGATCACGGCCAGCCGATCGGGGATCG
TGTCGCTGGCCAGCGCTTCGGTCGACGTCCAGAAGGGCGTGTCTTTCAAG
CCCGGGATCGGTGGAATCGCCGGACTGGCCCCGGTGGCGATGAGGCAGCG
GTCGAAACTCACCTCGCGCATCCCGTCGTCAGCGGTTGCCACGGTCAGCG
TGTGCGCATCCTTGAATCGGGCATCGCCGCGCAGCACGGTGATGGTCGGG
GTGCTCGTCAGGATGCCTTCGTACTTGGCGTGGCGCAGTTCATCGACGCG
CCCCTGCTGCTGAGCCAGCAAGCGCTTGCGCAGAATCTTCGGCGAGGCGG
CGGCAATGCCGTCATCGAACGGACTCTCGCGACGCAGATGCGCAATGTGG
GCAGCGCGGATCATGATCTTGGACGGCACACATCCGACGTTGACGCAGGT
GCCGCCGAGAGTGCTGCGCTCGATCAGCGTCACACGCGCCCCTTGCTCGA
CGGCCTTCAACGCCGCCGCCATCGCCGCGCCGCCGCTGCCGATCACGGCC
ACGTGCAGTGCAGCCTCATCGTCCTCGCGCTTTGGTTCGCCGCCCAGCCG
CTCTTGTGCATTGTTCAGCAGGTCGCTGGGTTGCCCCGGCGCATCGGCAA
GCTGCGCTCGGTAACCGAGTGCGGATACCGCCGCGACCAGCGAGGTCACG
TCCGCGGCGGTACCTACGCTGGCCTCAATCTCGGCCCGGCGCTGTGGGTA
GGACACTGAGGCCGAACGCACGCCGGGCACCTTTTCCAAGGTCTGCTTGA
CGTGCTCGGCGCACGACCCGCAGGTCATGCCATCGATGTGCAGCGTGATC
GCCTCGGTCATGAGCGTGTGCTCACTTCTTGACGGTAGACGGGTAGCCGG
CGTTCTCGGTGGCTTTGGTCAACGCGGCCGGAGTGGTCTTGGCATCGTCG
TAGGTTACCACCGCCTCCTTGGGCTCCCAGGTCACCTTGGCCTCGATGAC
GCCTTCGACCTTGGTCAGCGCCTTCTTGACCGTGATCGGACAGGTGGCGC
AGGTCATGCTCGGCACCGACAGCGTGACGGTTTTGGTGGCGGCCCAGGCG
GGAGCGCTGAGGGCAACGGTCAGAGCGAGCAATGCGACGAGTTTCTTCAT
GGCAATCTCCTTTCAGTAGAACAGGGGCATGAGGTAGGGGAACACGAGCG
CGATCAGCACCAGAGCGGTGAAGATCCAGAAGATCACCTTGTAGGCCGTC
CGCACCTGGGGCACGGCGCATGCGTCGTCCGGCGCGCAGGCGCGAGCCGG
CCGGAAGATGCGACGCCACGCGAAGAACAGCGCCACGAGCGCCACGCCAA
TGAAGATCGGCCGGTACGGTTCCAGCGCGGTCAAGTTGCCGATCCAGGCG
CCGGAGAAACCCAGCGTGATCAGCACCAGCGGACCGAGGCAGCAGGTCGA
GGCGAGGATGGCGGCGAGGCCACCGGCGGCCAGTGCACCGCGGCCGTTGC
TGGGGTCTGCCATGTGAGGGATCTCCTTCCGAGACGTTGCGTGATGCGCT
AAGGTTACTTCCGTAGTCAAGTACGGAGTCAAGCGCGATGGTGAACGATC
CGCAAACACTGACCATCGGGGCTTTCGCCAAGGCCGCTGGGGTCAACGTG
GAGACCATCCGGTTCTATCAGCGCAAGGGGTTATTGCCAGAACCAGGTCG
GCCCGTCGGCAGTATTCGCCGCTACGGATCGGCGGACGTGGCGCGGGTGC
GTTTCGTGAAATCCGCCCAGCGGCTGGGGTTCAACCTGGACGAAGTCGGC
CAACTCCTACAGCTTGAGGACGGCACTCACTGCAGCGAAGCCGCCGAGCT
GGCTGCGCTCCAGCTCACCGACGTGCGCACCAAGATGGCGGACCTGACGC
GAATCGAAGCGGTGCTGTCACGGTTGGTCAACGAGTGCCATGCGCAGCGA
GGCACTGTGTCGTGCCCGCTGATCGATTCTCTGCACGGGAGCTAGGCGCG
TGGCTTAACCCGGTTTTCCGTTCCACTGCGCCTCAAACCCCAGTTCGAGC
CGGGGGCAAGGTGACCTGCCACTGATTGTTTCCTTGCACCGACATGCGCC
AGACAAAGCCCACACTGAAGGCTAAAAGCGCGTAAGACTTGCGATACCAG
AAACCTACCGAACGAGAGCTGTCAGACAAGAAGGGCTAGTGCGGTCTTCC
CACACTAAAATCCGGATACCC