IS Name: ISStma13 - Family: IS3 ssgr IS407
Type: Complete

Composed by 2 ORFs
ORF(s): Smlt2416-Smlt2417
% of size:100% of reference copy ISStma13

IR Left:
TGCGACGTCCCCCCGAGATTGAGTAGCGAAGCGGTTTGGAGTCCAATCCTC
IR Right:
TGCGCACGCGACGTCCCCCCGGCTTGAGTAGTGGGCGGGTTTAGAGTCCGG
Borders:
CGGCCCCGCAGAAGTTCCGGTGCCCTACTCCGTTCTTGGCATGCCAAACG () ATTACATGGGCCGCAAGTGGCTCATGATCGATGCTAGGACTCCCAAGGAG
GC% Left (500bp): 60%
GC% IS: 61%
GC% Right (500bp): 56%

IS Sequence
TGCGACGTCCCCCCGAGATTGAGTAGCGAAGCGGTTTGGAGTCCAATCCT
CAATGACAAGGAGATTGGACGTGAAGAAGCGCTTTTCCGAAGAGCAGATC
ATCGGCTTCCTACGCGAAGCTGAGTCCGGCATGCCCATCAAGGACCTCTG
CCGCCAGCATGGCTTCAGCGAGGCCTCGTACTACCTGTGGCGCAGCAAGT
TCGGCGGCATGAGCGTGCCCGACGCCAAGCGGCACAAGGATCTGGAGGCG
GAGAACACACGCCTGAAGAAGCTGCTGGCAGAACAGGTCTTCGAGAACGA
CGTCATCAAGGATGCGTTGCGAAAAAAGTGGTGACCGCGCCGGCGCGCAG
GCTGCTGGTGCGGAGCATGGTCGAGAAGGGGTTGAGCGAGCGGCGAGCGC
TGACGGTGGTGCGGATGAGCGCTAGCGCGCTGCGCTATGAGCCTCGGCCC
GACAACAACGTTGAGCTGCGCGAGCAGATTGCTGCGCTGGCGCATCGGCA
CAGACGCTACGGGGTGGGCATGATCCATCTGAAGCTGCGGCAGAAAGGAC
TTGTCGTGAACTACAAGCGAGTGGAGCGGCTCTATCAGGAAGCGGGCCTG
CAGGTGCGACGCAGAAAGCGTAAGAAGGTGCCGGTTAGCGAGCGCCAGCC
CCTCCTGCGGCCGTCCGCTGCCAATGAGGTGTGGTCGATGGACTTCGTGT
TCGAGCGTACCGCAGAAGGCCGGGTGGTCAAGTGCCTGACGATCGTCGAC
GACGCCACCCACGAGGCTGTGGCCATCGAAGTGGAGCGGGCAATATCCGG
GCAAGGCGTGTCCAGGGTACTGGACAGGCTGGCCATGCAGCGCGGCTTGC
CACGAGTGATCAGGACAGACAACGGCAAGGAGTTTTGCGGTAAGGCGATG
GTGGCTTGGGCTCACGAAAAGGAAGTTGCCCTGCGTCTGATCGAACCGGG
CAAGCCGAACCAAAATGCGTACATCGAGTCCTTCAACGGACGGCTGCGCG
ACGAATGCCTCAACGAGCACTGGTTCCCGACGTTGCTTCATGCCCGCACC
AGTATCGAAAGCTGGCGGCGCGACTACAACGAAGAAAGACCAAAAAGAGC
GCTTGGCGGTCTAACACCCGCCCAATACGCCGCGCAGTTGGCGGCGAAGA
ACGATAACATCAGCACCGGACTCTAAACCCGCCCACTACTCAAGCCGGGG
GGACGTCGCGTGCGCA