IS Name: ISStma14 - Family: IS3 ssgr IS3
Type: Complete

Composed by 2 ORFs
ORF(s): Smlt3042-Smlt3043
% of size:100% of reference copy ISStma14

IR Left:
TGAAAGGGTTCATCCCCGTTTTCACGGACACTTACAAGAAGGCCGATTCAG
IR Right:
TCGGGTTCTACCCCGAAATCACGGACGGTTCTAAAAGAGCTGCAACCTTCT
Borders:
CAGGGAGGTCTTGCAGATTCTTGATGCTTTCAACCATTTCTTCTGAAAAC () TCGTGCCATCGGCGGCTTGAGTCCGATGCAAAGTGAGATCATTTCGACCT
GC% Left (500bp): 55%
GC% IS: 60%
GC% Right (500bp): 54%

IS Sequence
TGAAAGGGTTCATCCCCGTTTTCACGGACACTTACAAGAAGGCCGATTCA
GGCCATGAGGAGTGTTCATGTCGAAGCGAAGGAAGTTCAGCGCCGAGTTC
AAGCGTGGTGCGGTGGAGCAGGCAAGCCAGTCGGGTGTGAGCTGCGCCCA
GGTAGCCCGGGAGCTGGGAATCCGGGATACGTTACTGACACGCTGGAAGC
GTGAGGCGCAGGGTCAGGGGTCAGTCGTATTTGCTGGTGCCGGGACGCCC
CGGGACGAGGAGCTTGCGCAGTTGAAGCGCGAACTAGCCCGGGTGAAGAA
GGAGCGGGATTTTTTGCGAGAAGCGGCGACGTTCTTTGCCAAGGGATCAT
CCTGAGGTATCAGGTGATCGAACGTTGCCGCGACGAGTTTCCGGTTCGAC
TGATGTGCCGCTGTCTGAAGGTGTCGGCCAGTGGCTATTACGATTGGAGC
AAGCGCCTGCCCAGTGCCGGTCAGCTCGAAAATCAACGTTTGCTCGACCA
GATCCGCGCGTTGCATGAGGACAGTCGGGGCACACTTGGCGCAGGCCGGA
TGCAGGAAGATCTGGCCGATGCCGGCCATAGCCTGAGTCTGAACCGGGTG
GCGCGCCTGATGGCAGCTGACGGCTTGCAGGGCTGGCCACGACCGAAGCG
CCGAGGCCAGCAAGGCAGGCCTGCGTTGACTCTGCCAGGCGTGCGTAACC
GGCTGGAGCGGGACTTCAGCGCATTGGAGCCGGAGACCAAGTGGGTCACG
GATATCACCGAGATCAAAACCCAGCAGAGCAAGCTGTATCTGTGCATCGT
TCTGGATCTGTTTGATCAGCGAGTGGTGGGCTGGTCGATGCAACACCGCC
AGGACCGTCAGATGGTGATTCGTGCGGTGCAGATGGCAGTCTGGCAGCGT
CAAGAAAGTTACGAGGTGATCCTGCATTCGGATCGTGGCACCCAGTTTCG
CAGCGGCGACTATCAGCGTTATCTAGCGGCCAACAGCCTGGTCTGCTCGA
TGAGCGCGGTGGGGCACTGCGGGGACAACGCTGCGTGCGAAGGCTTCTTT
GGCCTGCTCAAACGCGAGCGGATCTATCGAACGAGCTACCCGACACTGGA
TGCAGCACGAGCGGATGTGTTTGACTACATCGAGCGACGCCACAATCCAA
GGATGCGGCGAAGGGTCGCCAGGCAGGATCAGAAGGTTGCAGCTCTTTTA
GAACCGTCCGTGATTTCGGGGTAGAACCCGA