IS Name: ISStma15-p - Family: IS3 ssgr IS51
Type: Partial

Composed by 2 ORFs
ORF(s): Smlt2414-Smlt2408
% of size:

IR Left:

IR Right:

Borders:

GC% Left (500bp):
GC% IS:
GC% Right (500bp):

IS Sequence
TGGACCGGCCAGGATTTCGTAGACATCTCAGAGCCATAATCAATGGAAGC
GAGAGAGGTGTCTAATGGCAAGCAAACAGTACACGGATGAGTTCAAGGCC
GAGGCGGTCAAGCAGGTTACCGAAAGAGGCTTTGCGGTAGCCGAGGTTGC
CAAGCGGTTGGGGGTCTCGTCCCACAGCCTTTACCAATGGCTCCGCAAGT
CCAGGAGCGAGGCCTTGGCGGGCACGCCTGAGGGGTCGATGTTGCCGACG
CCGAAGGACTCAGCCGAGGTGCGGCGCCTGAAGGCCGAGGTGAAACGCCT
GACTGAGGAGCGCGACATCCTAAAAAAAG