IS Name: ISStma2 - Family: IS3 ssgr IS150
Type: Complete

Composed by 2 ORFs
ORF(s): Smlt0835-Smlt0836
% of size:100% of reference copy ISStma2

IR Left:
TGAAGTGACCCCCGGGAGTTGGACGTCAGATCCAACCCCGAGGGATACATG
IR Right:
TGAAGTGACCCCCGAGACTTGGACGGGGTCAGGCGGCCGATTGGGCCCGCT
Borders:
GTGCTGGGTCGGGCGGGTTGGGTCCGCGGGGGACGCCGTGAACCCGT (CCA) TGGGGGCTTGGCCGCGGCATCCATGCCGCGGACACCCCCGCGAACCC
GC% Left (500bp): 63%
GC% IS: 58%
GC% Right (500bp): 60%

IS Sequence
TGAAGTGACCCCCGGGAGTTGGACGTCAGATCCAACCCCGAGGGATACAT
GAACAGATATGACGCACGTTTCAAACTGCAGGTCGCCAAAGAGGCCTGCA
AGACCTCCACATCGGTCAAAGCCATTGCCCGTCGCCACGGCCTTGAGTTC
TCCACGGTCAGGCGCTGGGTGGCGACCTATCGGCTGCATGGTTGGCGCGG
ATTTCATCGCCAGGCCCGGTTCTATGACCTCCCGTTCAAGCTGGCTGTCC
TGGAAAAAATGAGCCAGGACGGCATGTCTGGGCGGGAGGCCACCACCTAC
TTCCAGATTGGTGATGCCGGCGCGGTGGGGCGATGGCGGCGGCTGTATGC
TCAAGGCGGTGCCCAAGCGTTGGCACCGCCTCCGCCGCTGCCCCGAAAGC
CGATGAAAAAGACCCGTTCGTCCAAGCCGCCTGAGGAAATGAGCCGCGAT
GAGCTGCTCAAGGAAGTCGCCTATCTGCGTGCGGAGACCGACTACCTAAA
AAAACTCGATGCCTTGATCCGGGAAGAGCAGGCGGCGCAAGACGCAAAGC
GCAAGCCATCCAAGGATTGAGGCAGGTTCATACGCTGTCGCTTCTGCTCG
AAGCGGCGGAGCTGTCACGCAGTACGTTCTATTACCAGAACCATGTCCTG
GCCCATCCGGATCAGGACGAGGCAGCCCTGTGCGAGCGCATCCGTGCAAT
CTACGATCAAAGCAAAGGGCGCTATGGCTATCGCACGGTGACGCTGGAAT
TGGCCAATCAGGGTCATCGGACCAATCACAAGCGGGTACAGCGCCTGATG
GGGGAGATGGGCCTGAAATCACGGGTACGGGTGAAGCGCTACCGGTCCTT
CAAGGGGGCCGCCAATGTTGTGGTTGGCAATGACCTCAATCGCCAATTCC
ACGCCGAGCGCCCCAACCAGAAGTGGGTGACCGACGTGACCGAGTTCAAG
GTACAAGGCATGAAGCTGTATCTGTCCCCGATCATGGACCTCTACAACGG
CGAAATCGTGGCTTATCAGATCAAGCGCCAGCCCGTGTTCGATCTGGTAG
GTCAGATGCTGGAGGAGGCCATCAAGAAGCTTTCGCCGGATGAGCGCCCC
ATGATCCACTCCGACCAGGGCTGGCAGTACCAGCATGAAAACTACCGGCA
CATGCTGGAAAAACATTCGTTGAAACAAAGCATGTCCCGGCGTGGCAACT
GCCTGGACAATGCGGCGATGGAGAGCTTCTTCGGGACGCTGAAGTCGGAG
TTCTTCTACCTGAACAGCTTTGACAACATCGAGAGTTTGGAGGCTGGGCT
GGTGGAATACATCCAGTACTACAACCAGGAGCGCATCAAACTGAAACTGA
AAGGTCTGAGCCCGGTAGAGTACCGGGAGCGGGCCCAATCGGCCGCCTGA
CCCCGTCCAAGTCTCGGGGGTCACTTCA