IS Name: ISStma2 - Family: IS3 ssgr IS150
Type: Complete

Composed by 2 ORFs
ORF(s): Smlt3544-Smlt3545
% of size:100% of reference copy ISStma2

IR Left:
TGAAGTGACCCCCGGGAGTTGGACGTCAGATCCAACCCCGAGGGATACATG
IR Right:
TGAAGTGACCCCCGAGACTTGGACGGGGTCAGGCGGCCGATTGGGCCCGCT
Borders:
TTGTTGGGCGGGGCGGTGTGGGTTGGCAGGACACGCCGTAAACCCAT (CCC) TGGGGGCTCGATGGCGCCATCCATGGCGCCAACGGTCCTGCCAACCC
GC% Left (500bp): 57%
GC% IS: 59%
GC% Right (500bp): 69%

IS Sequence
TGAAGTGACCCCCGGGAGTTGGACGTCAGATCCAACCCCGAGGGATACAT
GAACAGATATGACGCACGTTTCAAACTGCAGGTCGCCAAAGAGGCCTGCA
AGACCTCCACATCGGTCAAAGCCATTGCCCGTCGCCACGGCCTTGAGTTC
TCCACGGTCAGGCGCTGGGTGGCGACCTATCGGCTGCATGGTTGGCGCGG
ATTTCATCGCCAGGCCCGGTTCTATGACCTCCCGTTCAAGCTGGCTGTCC
TGGAAAAGATGAGCCAGGACGGCATGTCTGGGCGGGAGGCCACCACCTAC
TTCCAGATTGGTGATGCCGGCGCGGTGGGGCGATGGCGGCGGCTGTATGC
TCAAGGCGGTGCCCAAGCGTTGGCACCGCCTCCGCCGCTGCCCCGAAAGC
CGATGAAAAAGACCCGTTCGTCCAAGCCGCCTGAGGAAATGAGCCGCGAT
GAGCTGCTCAAGGAAGTCGCCTATCTGCGTGCGGAGACCGACTACCTAAA
AAAACTCGATGCCTTGATCCGGGAAGAGCAGGCGGCGCAAGACGCAAAGC
GCAAGCCATCCAAGGATTGAGGCAGGTTCATACGCTGTCGCTTCTGCTCG
AAGCGGCGGAGCTGTCACGCAGTACGTTCTATTACCAGAACCATGTCCTG
GCCCATCCGGATCAGGACGAGGCAGCCCTGTGCGAGCGCATCCGTGCAAT
CTACGATCAAAGCCAAGGGCGCTATGGCTATCGCACGGTGACGCTGGAAT
TGGCCAATCAGGGTCATCGGACCAATCACAAGCGGGTACAGCGCCTGATG
GGGGAGATGGGCCTGAAATCACGGGTACGGGTGAAGCGCTACCGGTCCTT
CAAGGGGGCCGCCAATGTTGTGGTTGGCAATGACCTCAATCGCCAATTCC
ACGCCGAGCGCCCCAACCAGAAGTGGGTGACCGACGTGACCGAGTTCAAG
GTACAAGGCATGAAGCTGTATCTGTCCCCGATCATGGACCTCTACAACGG
CGAAATCGTGGCTTATCAGATCAAGCGCCAGCCCGTGTTCGACCTGGTGG
GTCAGATGCTGGAGGAGGCCATCAAGAAGCTTTCGCCGGATGAGCGCCCC
ATGATCCACTCCGACCAGGGCTGGCAGTACCAGCATGAAAACTACCGGCA
CATGCTGGAAAAACACTCGCTGAAACAAAGCATGTCCCGGCGTGGCAACT
GCCTGGACAATGCGGCGATGGAGAGCTTCTTCGGGACGCTGAAGTCGGAG
TTCTTCTACCTGAACAGCTTTGACAGCATCGAGAGTCTGGAGGCTGGGCT
GGTGGAATACATCCAGTACTACAACCAGGAGCGCATCAAACTGAAACTGA
AAGGTCTGAGCCCGGTAGAGTACCGGGAGCGGGCCCAATCGGCCGCCTGA
CCCCGTCCAAGTCTCGGGGGTCACTTCA