IS Name: ISStma5 - Family: IS3 ssgr IS3
Type: Complete

Composed by 2 ORFs
ORF(s): Smlt0026-Smlt0027
% of size:100% of reference copy ISStma5

IR Left:
TGGGGTTCACCCCCGTTTTCACGGACACTTACGAGAAGGCCGATCAAGGCC
IR Right:
TCGGGTTCTACCCCGAAATCACGGACGGTTGTAAAAGGGCTGAGAACTTCT
Borders:
GTCAGCGGACAGCAGAATGAGCAGACCCAACTCAGTAGAGGATAAGGC (AT) TCAGGAGCTGGCTGAGGAGGAGAGGCGAGGCTCAGTAGCTGAAGAGCT
GC% Left (500bp): 60%
GC% IS: 65%
GC% Right (500bp): 66%

IS Sequence
TGGGGTTCACCCCCGTTTTCACGGACACTTACGAGAAGGCCGATCAAGGC
CATGAGGAGTGTTCATGTCGAAGCGAAGGAAGTTCAGCACCGAGTTCAAG
CGCGGTGCGGTTGAGCAGGCCAGCCAGCCGGGCGTCAGCTGTGCCCAGGT
GGCCCGGGAGCTGGGGATCCGGGATGCATTGCTGACCCGCTGGAAGCGGG
AGGCCCAGAGCCGGGGCCAGGTGGCCTTCGGTGGCACCGGGACGCCCCGG
GACGAGGAACTGGCGCGGCTCAAGCGCGAGCTGGCCCGGGTGAAGAAGGA
GCGGGATTTTTTGCGAGAAGCGGCGACGTTCTTTGCCAAGGGATCATCCT
GAGGTATCAGGTGATCGAACGTTGCCGCGATGAGTTTCCAGTGCGACTGA
TGTGTCGTTGCCTGCGGGTCTCGGCCAGCGGTTACTACGACTGGAGTAAG
CGCTTGCCCAGTGCCCGGGAGCGCGACAACCAGCGCTTGCTCGGCCGGAT
CCGTGAGTTGCATGAGGACAGCCGGGGCACATTGGGCGCCGGCCGGATGC
ATGAAGACCTTGCCGAGGAAGGCGAGACGGCGAGCCTGAACCGGGTGGCG
CGTCTGATGGCGACCGATGGCCTGCAGGGTTGGCCGCGACCGAAGCGGCG
AGGCCAGCGCGGCAAGCCGGCGCTGACGCCGCCGGGTGTGCGCAACCTGC
TGGAGCGGGACTTCACCGCGTTGGAGCCGGAGACCAGGTGGGTCACCGAC
ATCACCGAGCTCAAGACCCGGCAAGGCAAGCTGTATCTGTGCATCGTGCT
GGACCTGTTTGACCAGCGGGTGGTGGGGTGGTCAATGCATCATCGTCAGG
ATCGTCAGATGGTGATCAGGGCCGTGCAGATGGCGGTCTGGCAGCGCCAA
GGCAGCCATCCACTGATCCTGCACTCCGACCGTGGCAGCCAGTTCCGAAG
CGGCGACTACCAGCGTTACCTGGCGGCCAACGGCTTGGTGTGCTCGATGA
GCGCGGTGGGCCACTGCGGTGACAACGCCGCGTGCGAAGGCTTCTTCGGC
CTGCTCAAGCGCGAGCGGGTCTACCGCATGACCTACCCAACGCTCGATGC
CGCGAGGGCGGATGTGTTCGAATACATCGAGCGGTTCCACAACCCGAGGA
TGCGACGAAGGGTCGCCAGGCAAGACCAGAAGTTCTCAGCCCTTTTACAA
CCGTCCGTGATTTCGGGGTAGAACCCGA