IS Name: ISStma6 - Family: IS110
Type: Complete

Composed by 1 ORFs
ORF(s): Smlt0368-Smlt0369
% of size:100% of reference copy ISStma6

IR Left:
GGCGACCGTGTGGATCCAGGTCTTGCGACCGAGAAGTAGCTTGGGTCCCCA
IR Right:
AGTAGCAACTGTCTTGTCAGGGGCAGCCGAGGGCCACCTCGGCGTCTCGCT
Borders:
GATCTTATCTCTTGCCAATCTGGCACCTTGGGTGCCGAGAGCCCGGCGTG () GGGTGCAGCTTTTGCCTTTGACGTTGGGTCCGCCTTGAGCGAGCCGAGCA
GC% Left (500bp): 60%
GC% IS: 61%
GC% Right (500bp): 61%

IS Sequence
GGCGACCGTGTGGATCCAGGTCTTGCGACCGAGAAGTAGCTTGGGTCCCC
ACGCCGGATTCTCCCTGAACCGCCCGAACAGTTGGTTGAGTTGGCGCTCG
AACTGATAAGACTGGGCAAGCGGGGAGAGCTCTCGACCCTGTCAGCCTAG
CGGAGTTCTGCCATGTTTGGGATCGGGATCGATGTGAGCAAAGCCACGCT
GGATGTGGCCGTCCATGGAGAGCAGTTTCGCCAATTCAGCAACGACAAGC
GCGGCTTTGTGCGCTTGATTCGGTGGCTGAAGACGTGGCCGATCAAGCAG
GTCGTTCTTGAGGCAAGCGGGGGTTACGAGCGTGCTGCTCTGGATGTATT
GCACGCCGCTGGCCTGCCGATGGTACGAATCAATCCGGCGCGTGCACGGC
GATTTGCCCAAGGCACGGGCCGTGCCGCCAAGACCGATCGGCTCGATGCG
ACAGTGCTGGCACAGATGGCCCATTTGTTGCCGCTGACCCGCTACGTACC
GCCTGCTCCTTGGCAGCAGCGTCTGGCTGAATTTGCGCAATGCCGCAGGC
AACTGGTGCAGATGCGGGTCAGTGAGATGCAGCGCTTGCGGCGATTGGTC
GATCCGGATCTGATTGCAATGAAGCAACGCCATATAGCTCAGCTATCTGA
CGACCTGAAGCAGTTGGATAAAGCTATTGCCGAGCAGCTTGAGGGGCAGC
CTGGCTGGAAGAATATCGGCGCGCTCAAAGGCGTCGGCCCCATCCTGATC
AGCACACTGGCCTGCGAGTTGCCCGAACTGGGCAGCTTGGGAAGTAAAGC
CATAGCATCGCTGGTGGGGTTGGCCCCGATGAACCGCGAAAGTGGCACCT
GGCAGGGCTAACGGCGGATCAGTGGTGGGCGCGCGGTGGTACGCGAAGCC
CTTTACATGGCGGCCCTGACGGCCATCCGGTACGAGCCAAGGCTGCGCGC
GTTTTACGCTGGCCTGAAGGCCAAGGGCAAAGCGAGCAAGGTGGCGCTCG
TGGCGGTCATGCGCAAAATGCTGGTGATCCTCAACGCCCGTAAGCGAGAC
GCCGAGGTGGCCCTCGGCTGCCCCTGACAAGACAGTTGCTACT