IS Name: ISStma7 - Family: IS110
Type: Complete

Composed by 1 ORFs
ORF(s): Smlt0666
% of size:100% of reference copy ISStma7

IR Left:
TATCTGATGAAAATCTGTCAGCGTAGGTGTCGAGAGCCGGCGTGGGCCGCC
IR Right:
TGTAGCAACTGTGTTGATGGAGGGACTTGGCCCCTCCATGAGACGGGCACG
Borders:
GTGGGTCCGGTTGCGGGGGCGTGAGCGCCATGGATGGCGCGACCGAGCCT () TGGACGTATTTACGGCGTCCCCCGCAACCGGACCCACCCCGCCATCTCCC
GC% Left (500bp): 62%
GC% IS: 62%
GC% Right (500bp): 62%

IS Sequence
TATCTGATGAAAATCTGTCAGCGTAGGTGTCGAGAGCCGGCGTGGGCCGC
CGTACGAGCCTGGATCTCGACGATCGCCATGTAGCTTGGCGCCCACGCCG
GAATCTCCCTTGATCCGCCCGAACAGTTGCTGGAGCTGACACTCGAAGCG
ATAAGACTGGGCAAGCGGGGGAGCTCTCGACCCTTCCAGACTATACGGAG
TCGGGCAATGAACGGGATCGGGATCGATGTGAGCAAGCGCCGATTGGATA
TCGGCACGACAGACGGCCAGACCCTGCAGGTCAGCAATAGCCCCTCTGGC
TATGCCGAGTTGAGCACTTGGTTGAGTACGCGGCCGGCCATTCAGATCGT
TTTGGAAGCCACCGGCGGCTATGAGCAGACTGTCCTGGACTTCCTTCACA
AGGCCGGCCATCCGGTGATCCGTGCCAACGCACTGCGAGCGCGTAGACTG
GCTCAGGGGCTGGGTAAAGTGGCCAAGACGGACCGCTTGGACGCTCTTGT
ATTGGCGCAGATGGCCGCGCTGGTGGAATTGCCTTCCTATCAGCCGCTGG
AGCCCTGGCAGCGGAAACTGCGTGAGTTTGTGCGGGCGCGTCGACAAACG
ATGCAGGCACTGACCGTAGCCCGCCAACAGCAGGAAATGGTGACTGACCG
CGAGCTACGCCGGCAGATGCAAGGCAACATCATTCGCCTGCAAACACTGG
TCGAGCGGCTGGGCAAGCAGATCTCTGAACAGGTCGCGCAGCAGCCTCAA
CTGGCAGTGCTGAAGTCAATGAAAGGGGTCGGCCCGGCATTGCAGGCGGT
ACTGGCCAGCTACCTGCCTGAGTTGGGTCAGATCAGCGGAAAAGCCATTG
CCAGCCTGGTCGGCGTGGCGCCGATCTCCCACGACAGCGGAGCCATGCGA
GGGAGGCGAAGCATCCATGGCGGCAGGGCCGAGATCCGCCAGGTGCTCTA
CATGGCAGCCATGTCGGCCATGCGACATGAGCCACGATTGCGGGACTTTT
ACCGGTCGCTGCGGGCCCGCGGCAAGGAAGGAAAAGTAGCGATCGTGGCG
GTGATGAGGAAGATGCTGGTGATCCTCAACGCCCGGGTGCGCGACGCTGA
AAACGGGCTGGTCCCTGCCTAAGGCCAGCCAGGGCGCAAGACCAAAGGCT
GCCGGCCAGCGGCCGGCACTACCGTGCCCGTCTCATGGAGGGGCCAAGTC
CCTCCATCAACACAGTTGCTACA