IS Name: ISStma7-p - Family: IS110
Type: Partial

Composed by 1 ORFs
ORF(s): not_found
% of size: 4% of reference copy - ISStma7

IR Left:

IR Right:

Borders:

GC% Left (500bp): 71%
GC% IS: 60%
GC% Right (500bp): 71%

IS Sequence
TATCTGATGAAAATCTGTCAGCGTAGGTGTCGAGAGCCGGCGTGGGCCGC
CGCTACG