IS Name: ISStma9 - Family: IS3 ssgr IS51
Type: Complete

Composed by 2 ORFs
ORF(s): Smlt1662-Smlt1663
% of size:100% of reference copy ISStma9

IR Left:
TGAATCGCCCAGGGTTCCGTAGACACCTCGCAGCCATAAACTATGGCTTAG
IR Right:
TGAATCGCCCAGGGTTTTCTAGACAGTCGTCAGCCGTTTAGTGCGTACTGC
Borders:
TACGTCGTACTATGAGGTCCGCAATTCTCAGTGGCTGAGATTGTTCGACG () CTTTGGGGTCTGGAGAGGTGTGGTAACCACCATTTTCCAAAGATGTCCCG
GC% Left (500bp): 54%
GC% IS: 59%
GC% Right (500bp): 59%

IS Sequence
TGAATCGCCCAGGGTTCCGTAGACACCTCGCAGCCATAAACTATGGCTTA
GGCGGAGGTGGTTATGAGCACGAAGCGGTACACCGATGAGTTCAAGATCG
AGGCGGTCCGACAGATCGTTGAGTACGGCCGTCCGGTAGCGGAGGTTGCC
GAGCGACTGGGCGTGTCGATCCATAGTCTTTACGGCTGGAAGCGGCAACA
AGGCAAAGGCGATGTTGGCCGGCGTGTCGAGCAGGACCAGAACGCGGAAG
TGCGCCGCCTCAAGGCTGAGCTACGCAGGGTCACTGAAGAGCGAGACATC
CTAAAAAAAGCCGCCGCGTACTTTGCAAAGGGGTAAGAGCAAAGTACGCC
TTCATGAAGCAACACGCAGATGAGTTCGGCCTCGCGGCGATGTGTCGGAT
GCTTGGCGTCCATCGCAGTGGCTACTACGCCTGGCTAAAAGAGCCGGCAA
GCGCTCGCGACAAGGACGATCAGCGGTTGCTCGGCCTAATCAAGCACAGC
TGGCTGGAAAGCGGCTCTGTGTATGGCCACCGCAAAGTGACCACAGATCT
GCGCGAGCTTGGCGAGACGTGTAGTCGTCATCGCGTGGCACGCTTGATGA
AGAGCGAGGGGCTGCGGGCAATGGTCGGCTACGGTCGGCGACCACGCCCA
TTGAGCGGCCCTGTTGGATCAGTCGCCAAGAACGTTCTGGCTCGCGGCTT
CAAAGTCAGTGAGCCAAATCGCGCGTGGGTCACGGACATCACCTACATCC
GCACGTACGACGGCTTCCTGTACTTGGCGGTAGTGCTTGATCTGTTTTCG
CGTCAGGTCGTTGGATGGGCAACCCGACCAACTCAACATACGGACCTGGT
TTTGCAGGCGCTATTGGCTGCAGTGTGGCGGCGCAAGCCAAGCCCCGGGC
TTCTGCTTCACTCCGACCAGGGAACCCAGTTCACCAGCGAAGACTGGCAG
AGCTTCCTGCGCGAGCACGACATCGTGTGCAGCATGAGTCGACGAGGAAA
CTGCCATGACAACGCAGCGATGGAGAGCTTCTTCCAGCTACTGAAGCGGG
AGCGTATTAAGCGGAGGATCTACAGCAATCACGACGAGGCACGGGCCGAC
GTCTTCCAGTACATCGAGATGTTCTACAACCCAAAACGGCGGCACAGTTC
CAACGACGGGCTGTCCCCGGTAGAGTTCGAGAAGCAGTACGCACTAAACG
GCTGACGACTGTCTAGAAAACCCTGGGCGATTCA